| Başlık |
DizinTR.Com Arama Motoru Toplist site |
| Oylama Analizi |
 |
|
|
|
|
|
|
|
|
|
| 1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
|
| URL ve PR |
http://www.dizintr.com  |
| Oy Ver |
Oylama Sayısı : 4, Ortalama Değerlendirme : 5.25 |
| Zaman |
07-23-2006 |
| ETC |
Gelen : 0, Giden : 1, Yorum : 2
|
| E-mail |
Mail Adresi Gizlenmiştir |
DizinTR.Com Arama Motoru Toplist site arama motoru search engine Toplist adult porno siteni ekle
tagtagtagtagtagtagtagtagtag
|
|
|
Son 10 dakikada aranan Kelimeler |
| project pat , defari , play , blackstreet , ugly kid joe , gruesome stuff relish , chaos z , dust for life , bad religion , zmelkoow , ghost of the robot , gene simmons , rascals , bernd cluver , marion , dolores o'riordan , frost , sunny day real estate , ilhan sesen , burt bacharach , , mercyful fate , dead moon , caesar , , ray-j , masta ace incorporated , alice , hanoi rocks , insolence , peel , hate squad , falco , crimson glory , ryan adams , fisher , acron
, ufo , dust brothers , jaheim , jan josef liefers |
|
|
